50 1M Tris pH=8, 25 ul 20% SDS, and 800 μl ultrapure water were added to 125 μl of a 4 mg/ml solution of the 160 kDa (NL) standard protein. The Blue Prestained Protein Standard, Broad Range is a mixture of highly pure, recombinant, prestained proteins, covalently coupled with a blue chromophore, that resolves into 11 sharp bands when electrophoresed. The flask was charged with Reactive Orange 16 which was dissolved by the required volume of water. In preferred embodiments, each of the five or more labeled protein standards that has a molecular weight of 10 kDa or greater migrates within 5% of each of the five or more proteins in unlabeled form on the same acrylamide gels. Preferred conservative amino acid substitution groups are: valine-leucine-isoleucine; phenylalanine-tyrosine; lysine-arginine; alanine-valine; glutamic acid-aspartic acid; and asparagine-glutamine. • Monitoring protein migration during SDS-polyacrylamide gel electrophoresis. Novex sharp prestained protein standard dual. A naturally-occurring protein can be any naturally-occurring protein, and can be a prokaryotic or eukaryotic protein of any species. In another embodiment, a pre-labeled protein standard set of the invention comprises two or more proteins of different molecular weights that are labeled on cysteine and depleted in lysine residues. A sample can be a live cell, a biological fluid that comprises endogenous host cell proteins, nucleic acid polymers, nucleotides, oligonucleotides, peptides and buffer solutions. A "nontarget amino acid" can have the same reactive chemical group as a target amino acid or a different reactive chemical group. In preferred embodiments, the protein is made from a nucleic acid construct that includes a nucleic acid sequence encoding one or more copies of an amino acid sequence derived from a naturally-occurring thioredoxin sequence, in which the nucleic acid sequence has been mutated to delete one or more lysine codons or to change one or more lysine codons to non-lysine codons.
With the solution is stirring, sodium hydroxide was added dropwise to the stirred the solution until the pH is 10. This clone, labeled pTrc 50. For example, a selectively labeled protein can comprise one or more copies of a sequence from the C-terminus of one or more ADP-ribosylation factors (Schurmann et al. Invest New Drugs 38:547-557 (2020).
For example, labeling of a particular protein with a dye that has high specificity for a first amino acid and reduced specificity for a second amino acid can result in a population of labeled protein variants, in which the variants are predominantly labeled on the first amino acid, but vary in the degree of labeling of the second amino acid that is present on the protein. 21, 2007 (abandoned), which claims benefit of priority to U. The resolution of the gel was later decreased across the width (to make it compatible with). A protein that is "deficient in an amino acid" means that the protein has no residues of the amino acid. Blue Protein Standard, Broad Range, New England Biolabs. For example, the sulfhydryl group of cysteine is generally a stronger nucleophile than the amino groups of lysine, the N-terminus of a protein, histidine, and tryptophan, which are stronger nucleophiles than the carboxyl groups of the C-terminus of a protein, aspartic acid, and glutamic acid, and the phenolate of tyrosine. 12/263, 672 filed Nov. 3, 2008 (abandoned), which is a continuation of U. The following examples are intended to illustrate but not limit the invention. For example, modification of thiols with a thiol-selective reagent such as a haloacetamide, vinyl sulfone, or maleimide, or modification of amines with an amine-reactive reagent such as an activated ester, acyl azide, isothiocyanate or 3, 5-dichloro-2, 4, 6-triazine. 5 mg/ml solution of the 260 kDa standard protein.
Biozol Catalog Number:||BZL-JB-EPL-2500|. Insulin b-Chain Purification. Synthesis of Red Dye #1 (8-Anilino-1-Naphthalenesulfonic Acid-Aminophenyl Vinyl Sulfone; 8-ANS-APVS). EagI-50 kd-10HIS-PmeI. The dye was eluted in acetonitrile and the colored fractions were collected. 4-aminophenyl-2-sulfonatoethyl sulfone (2. In some embodiments of this aspect of the invention, a selectively labeled protein includes an amino acid sequence having homology to an amino acid sequence of a naturally-occurring protein, in which the naturally-occurring protein is naturally depleted in or deficient in a non-target amino acid. The resulting PCR product was Topo cloned into the pCR®-Blunt cloning vector (Invitrogen, Carlsbad, Calif., USA) using the Zero Blunt® kit (Invitrogen, Carlsbad, Calif., USA). The width of bands visible to the naked eye from proteins having a molecular weight of at least 20 kDa to less than 100 kDa range in width from 0. At this time lactose is added to the culture to a final concentration of between 0. 5 μl 400 mM TBP was added and the protein sample was incubated for 20 minutes at 70° C. The sample was then cooled for 5 minutes at room temperature or until the temperature was below 50° C. 100 μl 10 mg/ml Uniblue A in water was then added to the peptide sample and the sample was incubated for 3 hours at 50° C. Novex sharp prestained protein standard.com. 10 kDa BenchMark™ Standard. The invention also includes nucleic acid constructs that encode proteins that comprise two or more copies of an amino acid sequence homologous to an amino acid sequence of a naturally-occurring protein, in which all of the lysine codons have been deleted or changed to non-lysine codons. 217: 220-230; and Schagger H (2001) Methods Cell Biol.
This generally occurs 14-17 hours after inoculation. 11B provides the deduced amino acid sequence of the pTrc 260 kd expression product (SEQ ID NO:41). 3-HIS-Pme I insert that had been digested with AvrII and PmeI and gel purified. 7 kd) and the remaining five identical repeats were set at 258 bp (each providing a translation product of 9. This application is a division of U. S. application Ser. Novex sharp prestained protein standard.html. A solution can include one or more buffers, reducing agents, chelators, alcohols, detergents, or dyes. The protein is centrifuged at 8000×g for 10 minutes and liquid is discarded taking care not to discard the protein pellet. Reactions of these groups with a nucleophile-interacting group of a label will be more or less efficient depending on factors that include but are not limited to the reactive group of the label, the strength of the nucleophile group of the amino acid, and the pH at which the reaction occurs. 21, 2007 and having a size of 87.
The diazonium salt should not be allowed to dry out. In one aspect, the invention includes a pre-labeled protein standard set that includes two or more proteins selectively labeled on a first amino acid with a labeling compound and depleted in a second amino acid capable of reacting with the labeling compound, in which the two or more selectively labeled proteins includes different numbers of copies of an amino acid sequence having at least 70% homology to at least 30 contiguous amino acids of a sequence of a naturally-occurring protein. The yield was calculated by standard methods. • Monitoring protein transfer onto membranes after western blotting. The Thio ORF of 279 bp was truncated to meet the molecular weight requirements of the final product. A selectively labeled protein can be a naturally-occurring protein isolated from cells, tissue, organisms, biological samples, or media, or can be made using recombinant methods. In preferred embodiments, all of the protein standards of the pre-labeled standard set are separated such that the bands do not overlap the widths of the bands on a gel of each of the electrophoresed proteins of the set having a molecular weight of 10 kDa or greater do not vary by more than 2-fold and the band intensities of the proteins of the pre-labeled protein standard set having molecular weights of 10 kDa or greater do not vary by more than 2. Using the unique restriction site (Avr II), located between 50 kDa Thio repeat fragments 2 and 3 in the pTrc 160 kDa protein construct (FIG. The lysis is performed for 1 hour at room temperature on shaker or rotary mixer. Ab116028 has been referenced in 16 publications. If the pH was less than 7.
Therefore a gel-based method for protein quantitation is preferred for the molecular weight standard proteins. One or more proteins of a set of labeled protein standards can be selectively labeled, for example, on the sulfhydryl group of cysteine, on the primary amine of an N-terminal amino acid and/or the primary amine of lysine, on the secondary amine of the imidazoyl group of histidine or the indole ring of tryptophan, on the carboxyl groups of the C-terminal amino acid or of aspartate or glutamate, on the thioether of methionine, on the phenolate of tyrosine, or on the amidino group of asparagine. Background Information. In the context of the present invention, "selectively labeled" means labeled predominantly on particular sites of a biomolecule. 11/781, 251 filed Jul. 10 ul of 400 mM tributylphosphine (TBP) was added per every ml of solution (to 4 mM final concentration). All or a portion of the amino acid sequence of a lipoamide dehydrogenase, glutathione reductase, or thioredoxin can be incorporated into a protein for use as a pre-labeled protein standard that is selectively labeled on cysteine. 4_F: |(SEQ ID NO: 28).
The invention provides individual pre-labeled proteins that migrate within 10%, within 7%, within 5%, within 4%, within 2. The final OD is generally 10 or greater. 1% SDS and then the sample was loaded. In some preferred embodiments, a protein standard selectively labeled on cysteine is depleted in or has an amino acid sequence with a reduced number of residues of at least lysine relative to the corresponding wild-type amino acid sequence. A pre-labeled protein standard set can include one or more proteins that is not selectively labeled. In some embodiments, the recombinant nucleic acid constructs used to produce the protein standards are further mutated to allow alternate codon usage for the same amino acid from copy to copy to reduce the risk of genetic recombination. Clones were screened by colony PCR to identify positive expression constructs using the following primers: #24 pTrCHisFOR: GAGGTATATATTAATGTATCG (SEQ ID NO:18) and #12 pBAD_Rev: GATTTAATCTGTATCAGG (SEQ ID NO:19). The overloading of proteins of the standard set leads to bands on the gel that are broad and not sharply delineated, making it difficult to assess the migration distance of the protein of a particular molecular weight. The bound protein is eluted with addition of 5 ml 8M urea, 20 mM phosphate, 500 mM NaCl pH=4 to the top of the column and collecting 1 ml fractions.
Additional pTrc BH expression clones were obtained by restriction digests using one of the five unique sites depicted in FIG. Protein molecular weight standards were produced in large quantity by inoculating a 2.
keepcovidfree.net, 2024